EST details — SGN-E505137

Search information 
Request: 505137Match: SGN-E505137
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C300765Clone name: KS09068C08
nocartOrdering Not Available
Library Name: KS09Organism: Capsicum annuum

Tissue: Young fruit (0.5-2 cm)
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E505137Length: 589 bp (974 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E505137 [] (trimmed) AGTACACATCCTCAAACCACTTCTGTTTCTCTCACAAATTGATTCTGTGGTCTGTAATTTGAGTTCCAACATCATGGCTACGCAAGGTCAAGTCA
TCACCTGCAAAGCTGCCGTGGCCTGGGAACCCAACAAGCCTTTGGTGATTGAGGACGTGCAGGTGGCTCCACCACAGGCCGGTGAAGTCCGTGTT
AAAATTCTGTATACTGCTCTCTGCCACACCGATGCTTATACCTGGAGTGGCAAGGATCCTGAGGGTCTCTTCCCATGTGTTCTTGGTCATGAGGC
TGCAGGGATAGTAGAAAGTGTTGGTGAAGGAGTGACTCACGTTCAGCGAGGAGACCATGTTATACCTTGTTACCAGGCAGAATGCGGAGAATGCA
AGTTCTGCAAATCACGAAAGACTAATCTTTGTGGCAAAGTAAGGGCTGCTACTGGAGTGGGAGTTATGATGAGCGACCACAAGAGTCGGTTTTCT
ATCAATGGAAAATCAATCTATCATTTCATGGGGAACTTAACCTTCAGTCAATACACTGTTGTCCATGATGTTAGTGTTGCAAAGATTGACCCACT
AGCTCCTCTGGAGAAAGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E505137] SGN-U196715 Capsicum annuum Build 1 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T307469 [Download][View] Facility Assigned ID: KS09068C08
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0096 Quality Trim Threshold: 14.5