Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E505905

Search information 
Request: 505905Match: SGN-E505905
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C296020Clone name: KS10009D12
nocartOrdering Not Available
Library Name: KS10Organism: Capsicum annuum

Tissue: Hairy root
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E505905Length: 467 bp (1435 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E505905 [] (trimmed) GAGAGAGAGAGGCGCGGAGTTTTGTGTGAATAGAGAGTGTTGTTCTGGTCAGATCGAGTCAACTGAAGATGCCTTCTCGCCGGCGAACTCTTTTG
AAAGTCATTATCCTCGGCGACAGCGGGGTTGGAAAGACCTCGTTGATGAATCAATATGTGAATAAGAAGTTCAGCAATCAGTACAAAGCAACTAT
TGGAGCTGATTTCTTGACAAAGGAAGTGCAGTTTGAAGATCGGCTCTTTACTTTACAGATTTGGGACACTGCTGGCCAAGAGAGATTTCAGAGTC
TTGGTGTCGCCTTCTACCGCGGTGCTGATTGTTGTGTCCTTGTTTATGATGTAAATTCAATGAAGTCATTTGAAAACTTAAACAACTGGAGAGAA
GAGTTCTTAATTCAGGGCAGCCCATCCGATCCAGAAAATCTTCCATTTGTTGTGCTGGGGAACAAAGTTGATGTTGATGGTGGAAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E505905] SGN-U197026 Capsicum annuum Build 1 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T302724 [Download][View] Facility Assigned ID: KS10009D12
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0251 Quality Trim Threshold: 14.5