Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E506274

Search information 
Request: 506274Match: SGN-E506274
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C296389Clone name: KS10015G06
nocartOrdering Not Available
Library Name: KS10Organism: Capsicum annuum

Tissue: Hairy root
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E506274Length: 452 bp (1123 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E506274 [] (trimmed) ATACTTTCTTTACGTGTCTTTAATTCTCCCACGTAACATTCACATATCAGATTCCGATCATTTCTCGCCGGTAAAATTTCCTCCGTCACCGGCGA
ATTTCATCTCCGTTCGATCTGCAATGAATCCTGAATATGACTACCTCTTTAAGCTTTTGCTCATTGGTGATTCTGGTGTTGGGAAATCATGTCTT
CTTCTGAGGTTTGCCGACGACACATATCTGGAAAGTTACATAAGCACCATTGGAGTTGATTTTAAAATCCGTACAGTAGAGCAAGATGGGAAGAC
TATAAAACTTCAGAATTTGGGATACAGCTGGACAAGAACGCTTCAGGAGCCATCACTAGCCAGCTACTATCGTGGAGCCCATGGCATAATAGTTG
TGTATGATGTGACAGATCAAGAGAGTTTCAATAATGTCAAACAGTGGCTGAGTGAATTGATCGTTATGCTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E506274] SGN-U196547 Capsicum annuum Build 1 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T303093 [Download][View] Facility Assigned ID: KS10015G06
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0173 Quality Trim Threshold: 14.5