Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E507172

Search information 
Request: 507172Match: SGN-E507172
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C297287Clone name: KS10029D03
nocartOrdering Not Available
Library Name: KS10Organism: Capsicum annuum

Tissue: Hairy root
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E507172Length: 538 bp (978 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E507172 [] (trimmed) ATTTATACTTTGCTTTCGTTTGGCTTGTCAAGTCTTCTAGTTGATCAACATGGGTAAAGAAAAAGTTCACATAAACATTGTGGTTATTGGCCATG
TCGACTCTGGAAAGTCGACCACCACTGGTCACTTGATCTACAAGCTAGGTGGTATCGACAAGCGTGTCATTGAGAGGTTCGAGAAAGAAGCTGCT
GAGATGAACAAGAGGTCATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAGGCTGAGCCGCGAGCGCGGTATCACCATTGATATTGCCTTGTGGA
AGTTTGAGACAACCAAGTACTACTGTACTGTGATTGATGCTCCTGGTCACAGGGATTTTATCAAGAACATGATTACTGGTACCTCTCAACCTGAC
TGTGCTGTGCTCATTATCGACCCAACTACTGGCGGTTTTGAAGCCGGTATCTCTAAGGATGGACAGACTCGTGAGCATGCGTTGCTTGCTTTCAC
CCTTGGTGTCAGGCAAATGATTTGCTGCTGCAACAAGATGGATGCGACCACTCCCAAGTACTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E507172] SGN-U196119 Capsicum annuum Build 1 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T303991 [Download][View] Facility Assigned ID: KS10029D03
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0122 Quality Trim Threshold: 14.5