EST details — SGN-E507178

Search information 
Request: 507178Match: SGN-E507178
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C297293Clone name: KS10029D10
nocartOrdering Not Available
Library Name: KS10Organism: Capsicum annuum

Tissue: Hairy root
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E507178Length: 502 bp (973 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E507178 [] (trimmed) GGTAAATGCAGATGTACCAATTGGTAAACATATTCCAGTTATTGATTTATCACAACCTTCAAATCATTCTATTCAGCAAATCATCAAAGCTTCTG
CTGAGTTTGGTCTCTTTCAGGTGATCAACCATGGAGTTTTAGAAAGCCTAATGGCTGATGCATTAGCAGTTTGCAAAGAGTTTTTCTATCTTCCA
ATTGAGGAGAAAGCAAAGTTTGTTGAGAATAAAGATGATGAGAGCTTAAGTGACTTTGAACCATCAATTGACCAAAGGCCAAAACTTTACATTGA
AAAAGAATACACACCAAAGAAAAATGGTTCAAAAACTAATGAGAAAGAAACTGTTTTTTGGAAAGATACTTTTGGACATGGTTGTCATCCTCTCA
CTCAAGATGTCATCAATTCTTGGCCTGAAAAACCACAAAAATATAGAGAAGTGATAGGTGAATATGCATTGGAGTTAAGGAAACTGAGCTTGAGG
ATTTTGGACCTAATGTGTGAAGGACTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E507178] SGN-U196386 Capsicum annuum Build 1 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T303997 [Download][View] Facility Assigned ID: KS10029D10
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.920 Expected Error Rate: 0.0052 Quality Trim Threshold: 14.5