Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E507265

Search information 
Request: 507265Match: SGN-E507265
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C297380Clone name: KS10030H07
nocartOrdering Not Available
Library Name: KS10Organism: Capsicum annuum

Tissue: Hairy root
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E507265Length: 388 bp (967 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E507265 [] (trimmed) CTTGTCAATCACTATCCAGCATGCCCAGATCCAAGTTTAACCTTGGGAGTTGGTGGACATTGCGATCCTAATCTCATAACCATTATCCAACAAGA
AGTTTATGGCCTACAATTATTGAAGGATGACAAATGGATTGGTGTGGATCCGATACCTGGTGCATTTGTTGTCAATTCAGGTTTACCAATCACGG
TAATTAGCAATGGGAAGCTAGCTAGTGTTGCACATCGAGTGGTGACGAACACAACTCATTCCCGTACATACATTGGTACTTTTATTTGTCCGGAT
GATATCGTTGGACCTGCCAAAGCACTTCTTGGTCCGGATAATCCCCCACGGTCTAAATCCTTTAAATGGGGCGAAGAGTTTATGCCACATTACCT
CAGCAAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E507265] SGN-U196298 Capsicum annuum Build 1 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T304084 [Download][View] Facility Assigned ID: KS10030H07
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0131 Quality Trim Threshold: 14.5