EST details — SGN-E507918

Search information 
Request: 507918Match: SGN-E507918
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C302383Clone name: KS11016F10
nocartOrdering Not Available
Library Name: KS11Organism: Capsicum annuum

Tissue: Early root
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E507918Length: 335 bp (1347 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E507918 [] (trimmed) ATAAATCCCAATTTCCTTTTCCCTCTTCTTGTTCTAGATACTTCCTTTTTGTGTGCTCCACAATCCCCATAACAATGGCGTCCGATCTGGAAACT
AGGGCTAAAGAAGCCTTCATTGATGACCACTTTGAACTCGCCGTTGACCTTTATACTCAAGCCATATCGTTGAGCCCTAAAAACCCTGAGCTTTT
CGCTGACCGTGCTCAGGCCAATATTAAACTCAATTATTTCACTGAAGCTGTTGTTGATGCGAACAAGGCCATTGAGTTGGATCCTTACATGTCAA
AAGCTTATTTGCGTAAGGGGTTGGCCTGTATGAAGCTCGAAGAATACCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E507918] SGN-U197040 Capsicum annuum Build 1 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T309087 [Download][View] Facility Assigned ID: KS11016F10
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0304 Quality Trim Threshold: 14.5