Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E508967

Search information 
Request: 508967Match: SGN-E508967
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C302639Clone name: KS11020A12
nocartOrdering Not Available
Library Name: KS11Organism: Capsicum annuum

Tissue: Early root
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E508967Length: 446 bp (1245 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E508967 [] (trimmed) AGTCATCAGAGTTGAAAAAAGGAAGTGAAAAATGGAATTTATTGCGGGATGAAGTTTTCAAAGCTTTAGAAGAATATGGTTGTTTTGAGGTTTTG
CTTGATGGAGAAATTCCAAAAGTGAAACTATATGAAAAGTTGAAAGAAGTTTCCAACTTTAATTTGGAGAAAATATTTGGAAATACACAAAGTGT
TTTAGTAGGTTATGATAGGTATAAACCTAAAGCACCACTTCAAGAGAGATTGGTGATTCCCAATGTCCTCAATGATGGTGTTATTGACAATTTTT
CTAAAAATCTTTGGCCTGATGGAGAGTCTGAATCCAGTGATTTGGTGCTCACTTACTCCAAGAAACTATCAGAATTTGATGATTTGGTAAAAAGA
ATGGTATTTGAGAAATTGGGATTGGAAAAATACTTGGATGAACACAAAAAATCAGGTGATTATTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E508967] SGN-U197150 Capsicum annuum Build 1 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T309343 [Download][View] Facility Assigned ID: KS11020A12
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.913 Expected Error Rate: 0.0057 Quality Trim Threshold: 14.5