EST details — SGN-E509349

Search information 
Request: 509349Match: SGN-E509349
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C303021Clone name: KS11026G12
nocartOrdering Not Available
Library Name: KS11Organism: Capsicum annuum

Tissue: Early root
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E509349Length: 242 bp (1298 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E509349 [] (trimmed) GCTCCTCAACGTCAGCCCAGACTACCCGCGATGGTGGTGAGACTTCTCGTAATAATGAAGTGGATGACAATTATGACGATGATGATGATGACTTC
GATGTGGACGAGTTAAATGAACTGGAAGCTAGCCTTTCAAAAACGTCGCTACAAATCAATGAACCTGGTAGTCGCGCTTAATCCTTGGCCCCAAA
ATTTATGCACATGGTATACTTATCGGTGCATGTGCATTCATATCCATGTGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E509349] SGN-U197443 Capsicum annuum Build 1 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T309725 [Download][View] Facility Assigned ID: KS11026G12
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0294 Quality Trim Threshold: 14.5