Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E511034

Search information 
Request: 511034Match: SGN-E511034
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C303864Clone name: KS12002F04
nocartOrdering Not Available
Library Name: KS12Organism: Capsicum annuum

Tissue: Placenta
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E511034Length: 417 bp (974 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E511034 [] (trimmed) AAACAAGTAGCGAAGGAGAAAGTACCCAGAGATTATTTGTGTTATGTCCGAGAGGGATCTTTCTTTTTTATACTAAGAATCTTGTACAGATCTCT
CTCGTTTACGATTTTTCTCATTAGCTATGGGTATCTGGGAATCATTTCTCAATTGGCTTCGAAGCCTCTTCTTTAAGCAGGAAATGGAGCTTTCA
TTGATAGGATTGCAAAATGCGGGAAAAACATCTCTTGTAAATGTTATTGCTACTGGTGGATACAGCGAAGACATGATACCAACTGTGGGATTTAA
TATGCGCAAAGTGACTAAAGGAAATGTCACTATAAAATTGTGGGACCTTGGAGGTCAACCCAGATTCCCGCAGTATGTGGGAGAGATACCTGTCG
TGCAGTTTCTGCTATAGTTTATGTTGTTGATGCTGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E511034] SGN-U197861 Capsicum annuum Build 1 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T310568 [Download][View] Facility Assigned ID: KS12002F04
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0193 Quality Trim Threshold: 14.5