EST details — SGN-E511180

Search information 
Request: 511180Match: SGN-E511180
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C304010Clone name: KS12004F01
nocartOrdering Not Available
Library Name: KS12Organism: Capsicum annuum

Tissue: Placenta
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E511180Length: 296 bp (1034 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E511180 [] (trimmed) CCAACTTGTATCTATTTCCATACTTCTCAGTCTCCCTTGTCCTTTTTCTCTTCCAACAAAAAATTCTATTGAGCAAATACACAATTCACATTCTT
GATCCAAGTTGAAGTGGAAGTTTTTGACCAAGATAAAAGGGAACCTTGTTTGCTGTGTTGGATGCTTGTGAGCTACAGTCTTTTGCTTAGTTGAC
AATACAATCTAATCTGTGAACCTTATGAGATCCAGTTTCATTTGCTGGAAGAACATTTCTTTTCTTGTGGATCAGATGGTGTCTTTGTGTGTCTG
AGAAAATGGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E511180] SGN-U198243 Capsicum annuum Build 1 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T310714 [Download][View] Facility Assigned ID: KS12004F01
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.930 Expected Error Rate: 0.0224 Quality Trim Threshold: 14.5