EST details — SGN-E511515

Search information 
Request: 511515Match: SGN-E511515
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C304345Clone name: KS12009F02
nocartOrdering Not Available
Library Name: KS12Organism: Capsicum annuum

Tissue: Placenta
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E511515Length: 329 bp (929 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E511515 [] (trimmed) CTAGAGCTAGTGTTTATATCAAGATGAAGAAGCCAAATGCTGCCATACGAGATGCAACTGCAGCATTGGAGATAAACCCAGATTCTGCTAAAGGT
TACAAATCTCGTGGCATTGCAAGAGCCATGCTGGGGCAATGGGAGGCAGCTGCTAAGGATCTTCATGTGGCTTCGAAGCTGGACTATGATGAGGA
AATAAGTGCTGTGCTTAAGAAGGTTGAACCAAATGCACATAGAATTGAAGAACACCGCCAGGAAGTATGATAGGATGCGCAAACCAACGCGAAGA
TAGAAAGAGTGAGCGTGAGAGACAACGAAGAAAGGCTGAAGCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E511515] SGN-U196448 Capsicum annuum Build 1 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T311049 [Download][View] Facility Assigned ID: KS12009F02
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.935 Expected Error Rate: 0.0200 Quality Trim Threshold: 14.5