Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E511658

Search information 
Request: 511658Match: SGN-E511658
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C304488Clone name: KS12013D06
nocartOrdering Not Available
Library Name: KS12Organism: Capsicum annuum

Tissue: Placenta
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E511658Length: 357 bp (1099 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E511658 [] (trimmed) CTCAAATTTTCAAGGAGATAAATCTGTACTGGTGAAATATGGGAGGCGGTAAGGATAAGGATGATTCTTCGGATAAGGGACTCTTTTCCCATCTT
GCGAGTGGTGCGGCTGGTCATTTTGCAGGTCATCATAGTGGATACCCTCCGCAGCAAGGGTATCCTCCTCAAGGGTACCCTCCGCAGCAAGGGTA
TCCTCCTCAAGGGTACCCTCCTCAGCAGGGGTATCCTCCTCACGGGTACCCTCCGCAGCAGGGGTATCCTCCACCAGGAGGTTACCCACCTTCTG
GTTATCCTCCACAACAAGGATANTCTCCAAAGGTGGTCATGGTCCTTCACACCATTCAGGGCATGGTGGTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E511658] SGN-U196682 Capsicum annuum Build 1 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T311192 [Download][View] Facility Assigned ID: KS12013D06
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0282 Quality Trim Threshold: 14.5