Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E514050

Search information 
Request: 514050Match: SGN-E514050
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C308110Clone name: cSML-10-G13
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C308110 [cSML-10-G13] Trace: SGN-T314922 EST: SGN-E514049 Direction: 5' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E514050Length: 234 bp (815 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E514050 [] (trimmed) TTTTTTTTTTTTTTTTTTACCAATGAACTATCCAATTTCTCCTTTTCTTTACCCTCTGGATGGGCAAAGGACTATAGCTGTATACACCTGTAGTC
CATAAGTTTGACATAAAACTGAAAGGAGTCTAGATGCTAGTAAAAACATACGACACATTTGTTTGTCTTAACAGAAGAACAGAATAATAACTGCC
AGCTAGAAGTTGTAGTAACTGAGCGGCCATCACAAAATACACAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E514050] SGN-U205784 Solanum melongena Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T314923 [Download] [View] Facility Assigned ID: cC-smflcSML10G13d1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.934 Expected Error Rate: 0.0029 Quality Trim Threshold: 14.5