EST details — SGN-E514097

Search information 
Request: 514097Match: SGN-E514097
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C308134Clone name: cSML-10-H22
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C308134 [cSML-10-H22] Trace: SGN-T314971 EST: SGN-E514098 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E514097Length: 426 bp (960 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E514097 [] (trimmed) TTCAGGATGGTTAGCTCATGATCCATCTGTACTGCATCGAGTTGTTTCATGTATTACTTCAGATACCATCAGTTGAACCTAAGAGGACAAGATGC
TTTGTTATAGCCGATGATCTTTTCCAGCTCTGTAAGGTACCGAAACAGAAGACAGTGTATGTTGTCACCAAAGTAATAGAAAAATTATCTGGATG
TAAGTTGCAGTTTACTTTTTCTTTTTCCTCCTAATTTATATCATAATTATTTGGTGCACTCTTTGGGTGCCAGGTGCTGGTACTCTCCAATTCTT
TTGCATCACTTTTCATTTTTCATGTATTTGCACAGACCAGACACCCAAACATCTGAACCTTGGGCAGTATATCGCATCAAACGTACCCAGCTTAA
AAGGTTTCGTTGAACTATCAACCATCCAGCAGAATGGGATGTCAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E514097] SGN-U206080 Solanum melongena Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T314970 [Download] [View] Facility Assigned ID: cC-smflcSML10H22c1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0027 Quality Trim Threshold: 12.5