EST details — SGN-E514138

Search information 
Request: 514138Match: SGN-E514138
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C308153Clone name: cSML-10-I5
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C308153 [cSML-10-I5] Trace: SGN-T315010 EST: SGN-E514137 Direction: 5' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E514138Length: 321 bp (843 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E514138 [] (trimmed) TTTTTTTTTTTTTTTTTTTTTTTTTTATGTAAGGACAACAAAAAGCAGTAAAAAGCTTGATTCATTCCTGACAAGTCAAACAGTAAAAGCAGAGC
TCAAAATCACTCAAAGATAAACAAGTTCCGCTGGTTATTCCATTACACTTAAACAAGAAGACCACTCCCGGCCAAAAAACTAATACTCCAATGAT
TCAAGTAAATACTAAACAGGTTTCTTTTACTCCACAGCATCAAATGCCTTAAGCAACAGAAGCCATATGGCAGATCAAATTAATCACACGGGGGC
TGTATCCCCATTCGTTGGCATACCATGACACAACTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E514138] SGN-U205979 Solanum melongena Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T315011 [Download] [View] Facility Assigned ID: cC-smflcSML10I5d1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.924 Expected Error Rate: 0.0248 Quality Trim Threshold: 14.5