EST details — SGN-E514443

Search information 
Request: 514443Match: SGN-E514443
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C308313Clone name: cSML-11-B10
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C308313 [cSML-11-B10] Trace: SGN-T315317 EST: SGN-E514444 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E514443Length: 438 bp (997 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E514443 [] (trimmed) GATTGCATGCTTTGCTGTTTTGTGTATGCTGGTGGTTGCTTTCCATGCACAGGCATTGACTCGCGGCCAGGTTGCATCTGCCGTGGCTCCTTGCC
TCAGCTATCTCACCGGAGGCCCCTCCATCGGAGCAGGGTGCTGCAATGGAATTAGGGGTCTTGCGGCTGCAGCCAAGACCACAGCAGACCGAAAG
ACAGCATGCACTTGCCTGAAATCAGCCGCTGGTTCTATTAAGGGAATTAATACGGGCAAAGCTGCTGGTCTCCCTGGTCGTTGTGGAGTCAGCAT
CCCTTACAAGATCAGCCCATCCACGGACTGCTCTAAGATTCAGTAAGGCTAACTGTGTGATCATCATAATTCGGTATCGTGGGAAGAATCAATCA
AGAATAAGAGTGGCGTCGTGTGATCCTGCTTATGGATCTATTATTCCTATGGTGTATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E514443] SGN-U205648 Solanum melongena Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T315316 [Download] [View] Facility Assigned ID: cC-smflcSML11B10c1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0186 Quality Trim Threshold: 14.5