EST details — SGN-E514827

Search information 
Request: 514827Match: SGN-E514827
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C308529Clone name: cSML-11-K10
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C308529 [cSML-11-K10] Trace: SGN-T315701 EST: SGN-E514828 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E514827Length: 415 bp (959 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E514827 [] (trimmed) AAGGCGACGAACGACACGCTCCATTTCGAGATTTACATATTTTTTATTCTCCGATCGCCGGTCGCAGATCTCCGATCACCGTTGTACAGAGATGG
GGCTATCTTTCACCAAACTCTTTAGTCGCCTCTTTGCTAAGAAGGAAATGCGTATTCTCATGGTTGGTCTCGATGCCGCTGGTAAAACCACAATT
CTCTACAAGCTCAAGTTGGGGGAGATTGTTACCACTATACCTACTATTGGTTTCAATGTGGAAACAGTTGAATACAAGAACATCAGCTTTACCGT
GTGGGATGTTGGGGGTCAGGACAAGATTCGACCTCTATGGAGACATTATTTCCAGAACACACAAGGGCTCATCTTTGTGGTTGACAGCAATGACC
GAGACCGTGTAGTTGAGGCTAGGGATGAGCTACAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E514827] SGN-U206111 Solanum melongena Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T315700 [Download] [View] Facility Assigned ID: cC-smflcSML11K10c1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.986 Expected Error Rate: 0.0179 Quality Trim Threshold: 14.5