Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E515479

Search information 
Request: 515479Match: SGN-E515479
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C308873Clone name: cSML-13-A18
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C308873 [cSML-13-A18] Trace: SGN-T316353 EST: SGN-E515480 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E515479Length: 242 bp (452 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E515479 [] (trimmed) GCTTTTGCTGCATTTTTTTCCTCTCATCTTTTCGTTATTGGCTCTACCAAACCAACAAACTGTAGATTATCCAAGCTTCAAGCTTGTTATTGTGG
GTGATGGAGGAACTGGGAAGACAACATTTGTCAAAAGGCATCTCACTGGTGAATTCGAGAAATAATATGAACCCACTATTGGTGTGGAGGTTCAT
CCACTAGACTTCTTTACAAATTGTGGGAAAATTCGCTTTTACTGCTGGGATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E515479] SGN-U205906 Solanum melongena Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T316352 [Download] [View] Facility Assigned ID: cC-smflcSML13A18c1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0150 Quality Trim Threshold: 20.5