EST details — SGN-E515507

Search information 
Request: 515507Match: SGN-E515507
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C308886Clone name: cSML-13-A8
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E515507Length: 243 bp (464 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E515507 [] (trimmed) TGGATTCTTCGCCCAAGCCATTGTCACCGGAAAGGGTCCATTTTTTAACCTTGCCGACCACCTTGCTGACCCAGTTAACAACAATGCCTGGGCCT
TTGCCACAAACTTCGTCCCTGGAAAGTGAGCTTAACAAAATGTTCATGTTTAATCTCCAATTAGTGTGAGATTATGAGTTTTTAGCTTGTGAGAA
ATGAATCTATAAAAGGGGTCAATTATTTTCAAGCACTCTGGGTTATGGGTTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E515507] SGN-U205589 Solanum melongena Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T316380 [Download] [View] Facility Assigned ID: cC-smflcSML13A8c1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0275 Quality Trim Threshold: 14.5