EST details — SGN-E515527

Search information 
Request: 515527Match: SGN-E515527
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C308888Clone name: cSML-13-B1
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C308888 [cSML-13-B1] Trace: SGN-T316399 EST: SGN-E515526 Direction: 5' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E515527Length: 452 bp (588 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E515527 [] (trimmed) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCCACAATAGTATGAGACCATAGAATTCAAAATAACCGTTATTAACACACATGAGCCAGTAAGAT
ACTTTGATCCAATCATTGGCATGTTTACTTGTTTATCATTACACTTGCAATCCACACACAAGTACTTTTTTATTAACTTAATCACAAGACAGTCT
CAGCAGTAAGTATCAGATGACCAAATAGCCACCACTATTGCATGTCTATCTAAATGCTCACAGATCTCAGTTCTTCCTCCCTTCACATAAAATGA
AATGGTATCCATGTGTTGATTTAAACGGTGCACTGGTAGCTCCAACAGGGGTATTGAAGGCAACTTCCTGAAAGGGGCCTGCCATCTTTCCACGT
GGAAACCATCCCAAGTCCCCACCTTTCTTTCCTGAGGGGCATTCTGAGTAAGTTGCAGCTACCTTGGCAAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E515527] SGN-U205826 Solanum melongena Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T316400 [Download] [View] Facility Assigned ID: cC-smflcSML13B1d1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0075 Quality Trim Threshold: 14.5