EST details — SGN-E516491

Search information 
Request: 516491Match: SGN-E516491
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C309436Clone name: cSML-14-H6
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C309436 [cSML-14-H6] Trace: SGN-T317363 EST: SGN-E516490 Direction: 5' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E516491Length: 352 bp (503 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E516491 [] (trimmed) ATTTTTTTTTTTTTTTTTTTTAGGGCCTCATAAATCCAAAACATACGCTGGATAGAAAATAAAGGAAACATAAAACAGCTTTGTTGGAATTAAGA
AAAAATAACAGGAGAACCTAAGTACCATATAAAAACAAAGTGCCCCTAAAGACAATTTTGTTCCTAAAATGAAACTTAGAAGCCTTCTGGCTTGT
AGGCAATGAAACTGATGCATTGCACTTGACGCACATTGGCAAATCCAATGATTGTAATCCATGCTTGGGGGTATTCCTTCTTGCACTCTGCAACC
TAATTCAACACTTGGGCGGGATCAGTGCACCCAAACATGGGCAACTTACACATGGTCCAGTACCTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E516491] SGN-U205622 Solanum melongena Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T317364 [Download] [View] Facility Assigned ID: cC-smflcSML14H6d1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0286 Quality Trim Threshold: 14.5