EST details — SGN-E516621

Search information 
Request: 516621Match: SGN-E516621
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C309503Clone name: cSML-14-K23
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C309503 [cSML-14-K23] Trace: SGN-T317493 EST: SGN-E516620 Direction: 5' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E516621Length: 317 bp (447 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E516621 [] (trimmed) TTCACGGTTCTTGTTAAAGGTTTCCGGGTCAGCTGAAAGTCCAGCGGTGTCCCACCCGTAGTCACCAGGGAATTCACCAGTCAAGTAGCTTGGGG
GCTCACCAGAGAATGGTCCCAAGTACTTAACACGGTCTGGGCCATACCATGGGCTGCTAGATGCGGCAGGCTTGGGGACAGCCTTTCTCATAAAG
AACCTTCCATTTCCAGAGATTTCTGAGGCAGAGGGTGAGAGTTTCACTGCCTGTCCAGCAAAAGAAGGTGAAGAAAGAGCCATGGTAGCAGCTGC
CATGGTTTATAAAGAGGAAAGTGAGGGGGTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E516621] SGN-U205578 Solanum melongena Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T317494 [Download] [View] Facility Assigned ID: cC-smflcSML14K23d1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0168 Quality Trim Threshold: 12.5