EST details — SGN-E516862

Search information 
Request: 516862Match: SGN-E516862
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C309624Clone name: cSML-14-P24
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E516862Length: 314 bp (409 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E516862 [] (trimmed) CTTCAATGAAGAAAGCTGTTGTCCAACAAAAATTTCCCAGTCAGCAATGAGATATCTGAATTTCTCTAGCCCTCTCTGCGGACAAAGTAGAGCTT
ACCCATGACGTGAAGGATCGCAACAAAAGCTATGAAGCCAATACTCATCACAAGCACGACATTGGGGGAGATCTTGAGTCCGGGGGAATCATCAG
TGTAGAATTGAAGCATGGTACCACCTGCTCCTACAGCAGCCCCACCACCACCACCGGTCTTACTTCGACGCAGGTTAGCAGCTGCTGCAGCAGCA
GTCCCCCTTTGCGGTCCACCTACACCCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E516862] SGN-U205606 Solanum melongena Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T317735 [Download] [View] Facility Assigned ID: cC-smflcSML14P24c1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0083 Quality Trim Threshold: 20.5