Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E517105

Search information 
Request: 517105Match: SGN-E517105
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C309786Clone name: cSML-15-G19
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E517105Length: 405 bp (626 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E517105 [] (trimmed) AATCTAAAGAATTCTCTCCATTTTTAGCAAAATTGTTTTTATTTTCTTCCATTAATGGCAGGAAGAGGCAAAACCCTAGGTTCAGGAGCTTCAAA
GAAGGCTACTTCTCGTAGTAGCAAAGCTGGTCTGCAGTTTCCGGTGGGTCGTATAGCTAGGTTTCTGAAAGCTGGAAAGTATGCTGACCGTGTTG
GTGCCGGAGCTCCGGTTTACCTTGCTGCTGTTCTGGAGTACCTTGCTGCTGAGGTTCTTGAATTGGCTGGCAATGCAGCGAGGGACAATAAGAAG
ACTAGGATTGTGCCAAGGCATATTCAGTTGGCAGTGAGGAATGATGAGGAGCTGAGCAAGCTTCTTGGAGATGTGACAATTGCTAATGGTGGTGT
GATGCCCAACATTCACAACCTGTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E517105] SGN-U205683 Solanum melongena Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T317978 [Download] [View] Facility Assigned ID: cC-smflcSML15G19c1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0056 Quality Trim Threshold: 20.5