EST details — SGN-E517776

Search information 
Request: 517776Match: SGN-E517776
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C310177Clone name: cSML-3-D18
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C310177 [cSML-3-D18] Trace: SGN-T318648 EST: SGN-E517775 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E517776Length: 331 bp (665 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E517776 [] (trimmed) TTTTTTTTTTTTTCTTCTTATCCATAGGCAAAATCAATTAACAGGAGAATCCAAATACAGAATGTCTACATAGGGGAATTTCTGAGTTTTACATC
CTGCCATGTCAAAGTGCTTAGAAAATAACCACAATTTTAGAGACCATCAAAGAATCTCAAATGGTCTTCAAATGTCTCCCCATGGCGGATTTTGG
ACAGTGATCCATCTTCTTCCACCCAATACTCAGGTGGGCGCATCTTGAGATTGTAAGTTGATGCCATACTCATGCAATAAGCACCTGCATCATGA
ACTACCAAACCAGTGCCCCTAGTCGGGGTGGGAAGTTCACGGTCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E517776] SGN-U205690 Solanum melongena Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T318649 [Download] [View] Facility Assigned ID: cC-smflcSML3D18c1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0126 Quality Trim Threshold: 20.5