EST details — SGN-E518020

Search information 
Request: 518020Match: SGN-E518020
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C310304Clone name: cSML-3-L01
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C310304 [cSML-3-L01] Trace: SGN-T318894 EST: SGN-E518021 Direction: 5' Facility: Cereon
Clone: SGN-C310304 [cSML-3-L01] Trace: SGN-T318895 EST: SGN-E518022 Direction: 5' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E518020Length: 204 bp (674 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E518020 [] (trimmed) TTTTTTTTTTTTTTTTTTTTTACAAAGGAAACATCTTGACATGATCACCTACAAGTGGGTTGAGTTAAGCCAAGTGAAAACGTCGTACCAAAGAA
GATGACATACTAGCTCTCATCTCCATCATCCAGAACAAAAGAAAAGTTAATAACTACTAACGACAGTAGTAGTTAAGCCTACTTAGAACACACAA
CACTTGCTTACCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E518020] SGN-U205803 Solanum melongena Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T318893 [Download] [View] Facility Assigned ID: cC-smflcSML3L01a1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0184 Quality Trim Threshold: 14.5