Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E518087

Search information 
Request: 518087Match: SGN-E518087
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C310335Clone name: cSML-3-M16
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E518087Length: 369 bp (673 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E518087 [] (trimmed) CTGTATTGCCGCAATCGCCTCAGCTCTCTTCTCTCTAGAGTTTCTTAGTCTATCAAGATGGGTAAAGAGAAGACTCACATCAGCATTGTGGTCAT
TGGCCATGTCGACTCTGGAAAGTCGACTACTACTGGTCACTTGATCTATAAGCTTGGTGGTATTGACAAGCGTGTTATTGAGAGGTTCGAGAAGG
AAGCTGCTGAGATGAATAAGAGGTCATTCAAGTATGCCTGGGTGCTTGACAAGCTTAAGGCTGAACGTGAGCGTGGTATTACCATTGACATTGCT
TTGTGGAAGTTTGAGACCACTAAGTACTACTGCACTGTGATTGATGCCCCCGGACACAGGGACTTTATCAAGAACATGATCACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E518087] SGN-U205817 Solanum melongena Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T318960 [Download] [View] Facility Assigned ID: cC-smflcSML3M16b1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0210 Quality Trim Threshold: 14.5