EST details — SGN-E518376

Search information 
Request: 518376Match: SGN-E518376
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C310475Clone name: cSML-4-N18
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C310475 [cSML-4-N18] Trace: SGN-T319250 EST: SGN-E518377 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E518376Length: 309 bp (1082 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E518376 [] (trimmed) CGGTGTTGCAAGGCCTGCTGCTCCTTCTCCATCCTCCCCTGCTACCTTCAAAACTGTTGCACTTTTCAAAAAGAAGGCTGCCGCTCCTGCCAAAG
CAAAGGCCATCCCTGCTTCCCCAGCTAACGACGAGCTCGCCAAGTGGTACGGACCTGACAGAAGAATTTTCCTGCCCGAGGGTCTATTGGACAGA
TCAGAAATCCCTGAGTACTTGAACGGAGAAGTTCCCGGAGACTACGGCTATGATCCCTTTGGTCTCAGCAAGAAGCCAGAAGACTTCGCTAAATA
CCAGGCGTATGAGCTGATCCACGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E518376] SGN-U205881 Solanum melongena Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T319249 [Download] [View] Facility Assigned ID: cC-smflcSML4N18c1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.986 Expected Error Rate: 0.0015 Quality Trim Threshold: 20.5