SGN ID: SGN-C310492 | Clone name: cSML-4-P4 |  | Ordering Not Available |
|
Library Name: cSML | Organism: Solanum melongena |
Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants
There is no map position defined on SGN for this EST or others in the same unigene.
Sequence Id: SGN-E518410 | Length: 160 bp (1065 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E518410 [] (trimmed)
AAATCTCCATCAAATTCCAAGCAAAACCCACCAATTTTCTTGGCTTCTAGGTGTAGCAATCACCATGGCAGCTGTGTTTGAGTCCTTGAAGTTAT
GGGGTTTTTGGGCAGTTGTACTTGCTGCAGCTACGGCTGTGAAGGGGAATTCAGAAGGGGATGCT
[BLAST] [AA Translate]
Processed By: SGN |
Basecalling Software: phred |
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.930 |
Expected Error Rate: 0.0105 |
Quality Trim Threshold: 20.5 |