EST details — SGN-E518448

Search information 
Request: 518448Match: SGN-E518448
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C310517Clone name: cSML-5-B7
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C310517 [cSML-5-B7] Trace: SGN-T319322 EST: SGN-E518449 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E518448Length: 321 bp (454 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E518448 [] (trimmed) GAGCTGTTCCTGAAACTACTGCAAAGAAAGGCAACCAGTATCCTGTTGGTCCTATCTTGCTTGGGTTCTTTGTCTTTGTGGTCATTGGCTCATCT
TTGTTCCAGATAATAAGGACAGCAACCAGTGGAGGTATGGCTTAAGCATGCAAAGTTATACAAGTAGCGATGATAATAGGCTGCGCCTGCTTTCT
TGTAGAGTTGTTTTCCTCAAAGTTTAGCCGAATGTAGAAATTGAAGAGAAACTTCAGTAGGAATCGAGATTTTAATTTGTGAGACTCAAAATATA
AATTTTCTACTGTCTAAAAAAAAAAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E518448] SGN-U205723 Solanum melongena Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T319321 [Download] [View] Facility Assigned ID: cC-smflcSML5B7c1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0120 Quality Trim Threshold: 14.5