EST details — SGN-E518508

Search information 
Request: 518508Match: SGN-E518508
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C310560Clone name: cSML-5-F19
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C310560 [cSML-5-F19] Trace: SGN-T319382 EST: SGN-E518509 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E518508Length: 357 bp (445 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E518508 [] (trimmed) TGCACACCATTTAAAAGTTGGAGACTTTGGATTAAGCAAACTAATCAGGGTTCAGAACTCCCATGATGTTTATAAAATGACTGGGGAGACGGGAA
GCTACCGCTATATGGCACCTGAAGTTTTCAAGCACCGGAAGTATGACAAGAAGGTTGATGTTTTCTCTTTCGCAATGATCTTATATGAGATGCTA
GAGGGTGATCCACCATTATCCCACTATGAACCATATGAAGCAGCCAAGTATGTGGCAGAAGGACACAGGCCTATGTTCAGGGCAAAAGGTTTTAC
CCCAGAATTGAAAGAGCTGGTAGAGCAATGTTGGGCACCAGACATGAACCAGAGACCCTCATTTTTGGATAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E518508] SGN-U206135 Solanum melongena Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T319381 [Download] [View] Facility Assigned ID: cC-smflcSML5F19c1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0033 Quality Trim Threshold: 14.5