EST details — SGN-E518530

Search information 
Request: 518530Match: SGN-E518530
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C310574Clone name: cSML-5-G22
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E518530Length: 338 bp (933 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E518530 [] (trimmed) TTTTTTTTTTTTTTTTTTTACCAATGAACTATCCAATTTCTCCTTTTCTTTACCCTCTGGATGGGCAAAGGACTATAGCTGTATACACCTGTAGT
CCATAAGTTTGACATAAAACTGAAAGGAGTCTAGATGCTAGTAAAAACATACGACACATTTGTTTGTTTTAACAGAAGAACAGAATAATAACTGC
CAGCTAGAAGTTGTAGTCACTGAGCGGCCATCACAAAATACACATTAGCTAACTAAGACAATCTTAAGCCATTACTTGGCAAGCATTATGCGGAC
AAACTCCTCATAATTCACTTGCCCATCACCATCAATATTTGCCTCTCGGATCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E518530] SGN-U205784 Solanum melongena Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T319403 [Download] [View] Facility Assigned ID: cC-smflcSML5G22d1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0179 Quality Trim Threshold: 14.5