EST details — SGN-E519562

Search information 
Request: 519562Match: SGN-E519562
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C311404Clone name: cSML-8-C5
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C311404 [cSML-8-C5] Trace: SGN-T320436 EST: SGN-E519563 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E519562Length: 271 bp (531 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E519562 [] (trimmed) TTCTTCTTTCGAAAATCAGTTGTCAGAAGAAGCTAGCGACCCATAGAAAGCGCGTAAAGTGTGGGAAGTCAGTGAAAAACTCGTCGGGTTGGCTT
AGATTTTGCAGACTGACCTTATGCATCGCCAACGCGAACAGGAAAAGGGAGTTTGATGAGAGAAAATTTGAATCAAGATTCTGTCTTTGTAAAAT
TTTTGAGTTAGCAATAAATATCACTCACCTTGAATCATTTCTGATGATTCATTTATTTTTCAAAAAAAAAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E519562] SGN-U205728 Solanum melongena Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T320435 [Download] [View] Facility Assigned ID: cC-smflcSML8C5c1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0232 Quality Trim Threshold: 14.5