EST details — SGN-E520045

Search information 
Request: 520045Match: SGN-E520045
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C311645Clone name: cSML-8-P8
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E520045Length: 339 bp (623 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E520045 [] (trimmed) TTTTCTTTTTTTTTTTTTTAGGCAAAATCAATTAACAGGACAATNGGAATACTTAAAATCTACATGGGGTGTATTAAAAAGCTTTACATCCTGCC
ATGTTAAAGTGCTTATAAAATAACCACAATTTTAGAGACCATCAAAGAATCTCAAATGGTCTTCAAATGTCTCCCCATGGCGGATTTTGGACAGT
GATCCATCTTCTTCCACCCAATACTCAGGTGGGCGCATCTTGAGATTGTAAGTTGATGCCATACTCATGCAATAAGCACCTGCATCATGAACTAC
CAAACCAGTGCCCCTAGTCGGGGTGGGAAGTTCACGGTCCTTTCCCAGGAAATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E520045] SGN-U205690 Solanum melongena Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T320918 [Download] [View] Facility Assigned ID: cC-smflcSML8P8d1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0322 Quality Trim Threshold: 14.5