EST details — SGN-E520877

Search information 
Request: 520877Match: SGN-E520877
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C319085Clone name: Petunia-4-F02
nocartOrdering Not Available
Library Name: Petunia-DevAOrganism: Petunia hybrida

Tissue: all floral organs
Development Stage: several

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E520877Length: 602 bp (675 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E520877 [] (trimmed) GTTCTATTGAGGAGTCTGGCGAGCATATCATTGCTGGTGCTGGAGAACTCCACCTGGAGATCTGCTTGAAGGACTTGCAGGAAGATTTCATGGGT
GGCGCTGAAATTAAAGTATCTGATCCTGTGGTGTCCTTCCGTGAAACAGTCCTGGAGAAGTCTTGCCGTACTGTGATGAGCAAGTCCCCTAACAA
GCATAACCGTTTGTACATGGAAGCTAGACCCTTGGAGGAAGGACTTGCTGAGGCTATTGACGATGGACGTATTGGCCCTAGGGACGATCCTAAAG
TTCGTTCCAAGATCTTGTCTGAGGAGTTTGGTTGGGACAAGGATCTTGCAAAGAAGATTTGGTGCTTTGGTCCAGAGACAACTGGACCCAACATG
GTGGTGGATATGTGTAAGGGAGTTCAGTACTTGAATGAAATTAAGGATTCTGTTGTTGCTGGTTTCCAGTGGGCTTCCAAGGAAGGTGCATTGGC
TGAAGAGAACATGAGAGGTATTTGCTTTGAAGTCTGTGATGTCGTACTTCATGCTGATGCTATTCACAGGGGTGGTGGCCAAGTTATTCCCACTG
CTAGGAGGGTTATCTATGCTTCTCAGCTGACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E520877] SGN-U207581 Petunia hybrida Build 1 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T331037 [Download] [View] Facility Assigned ID: Petunia-4-F02.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0026 Quality Trim Threshold: 14.5