EST details — SGN-E521295
| Search information |
| Request: 521295 | Match: SGN-E521295 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C319503 | Clone name: Petunia-DevA-13-H12 |
| ||
| Library Name: Petunia-DevA | Organism: Petunia hybrida |
Tissue: all floral organs
Development Stage: several
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E521295 | Length: 252 bp (605 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E521295 [] (trimmed)
ATTATTTACTTGTGTTCACTGTAGTACACTTTGCTACTATGGCTCGCTCCATCTGTTTCTTCGCAGTTGCTACACTGGCATTGATGCTCTTTGCT
GCCTATGAGGCGGAAGCGGCAACTTGCAAGGCTGAATGCCCAACTTGGGATGGAATATGTATAAATAAAGGCCCATGTGTAAAATGTTGCAAAGC
ACAACCAGAAAAATTCACAGACGGGCACTGCAGTAAAGTACTCCGAAGATGCCTATGCACTA
GCCTATGAGGCGGAAGCGGCAACTTGCAAGGCTGAATGCCCAACTTGGGATGGAATATGTATAAATAAAGGCCCATGTGTAAAATGTTGCAAAGC
ACAACCAGAAAAATTCACAGACGGGCACTGCAGTAAAGTACTCCGAAGATGCCTATGCACTA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E521295] | SGN-U207537 | Petunia hybrida | Build 1 | 10 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T329151 [Download] [View] | Facility Assigned ID: Petunia-DevA-13-H12.g |
| Submitter: Dave Clark | Sequencing Facility: U Fla ICBR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.948 | Expected Error Rate: 0.0059 | Quality Trim Threshold: 20.5 |
Working
