Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E521837

Search information 
Request: 521837Match: SGN-E521837
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C319949Clone name: Petunia-DevA-18-F02
nocartOrdering Not Available
Library Name: Petunia-DevAOrganism: Petunia hybrida

Tissue: all floral organs
Development Stage: several

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E521837Length: 337 bp (575 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E521837 [] (trimmed) CCTACCCATTCGGTTATGAATGAAGAAGGTGTCGACCTCCCAAGATGGGTGCAATCAGTGGTACGAGAGGAATGGACAGCTGAAGTATTTGATCT
CGAGCTCCTTAGGTACCAAAACGTTGAGGAGGACATGGTCCAGCTTTTGCAACTCGCAGTTGACTGCACGGCTCAGTACCCGGACAGACGCCCTT
CTAGTGGCTGAGGTCACTAGCCGCATTGAAGAACTTTGCCGGTCTAGTTTCATGGATTCAGGAGGTGACATAATGGACAATGGAGAAGTGCAAAG
GGTAGATTCTGCAGCATGAATTTGAACAGGAAAATAGTTCCATCCCATTAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E521837] SGN-U208224 Petunia hybrida Build 1 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T330557 [Download] [View] Facility Assigned ID: Petunia-DevA-18RR-F02.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0050 Quality Trim Threshold: 14.5