Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E522128

Search information 
Request: 522128Match: SGN-E522128
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C320240Clone name: Petunia-DevA-21-F05
nocartOrdering Not Available
Library Name: Petunia-DevAOrganism: Petunia hybrida

Tissue: all floral organs
Development Stage: several

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E522128Length: 527 bp (586 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E522128 [] (trimmed) TTATGATGAAGTTATGAAGCTCCCAACCATAACTTTTAGAATGCAAGAGTTGAAACCAGGGAGTGAAGAATGGATTTCAGTGAGAGATGAAATCT
ACAAAGCTTTATAAGAATATGGTAGCTTTGAGGCTATACTTGATGGAATCCCTAAGGAGAGACTCTACGAAAAATTAATAAAAGAAGTTTTTGCC
CTTACTTGGGATCCAAAATTTGAAAATATTAAAAATTCAACTGGCTACCGTGTGAAAGACCCTCTTCTTCCACTTTTAGAGAGACTGCACATTCT
CAATGTCTTCGCTCCTGGTGCGATTGAAAGCTTTTCCAAGAATATTTGGCCTGATCATGAAGAGCAAGAATTTTGTGATTTGGTGCATTCTTACG
TCAACAGAATATATGAATTTGATGAGATGGTGAGAAGAATGATTTTTGAGAAATTGGGCATCGAAAAATACTTTGAGGAACAAAAAAACTCTACA
GCCTGTGCACTTGGCTTCATGAAGTACACAGTGCCTAAAGCTGAGGAGACAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E522128] SGN-U207462 Petunia hybrida Build 1 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T329792 [Download] [View] Facility Assigned ID: Petunia-DevA-21-F05.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.944 Expected Error Rate: 0.0043 Quality Trim Threshold: 14.5