Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E522702

Search information 
Request: 522702Match: SGN-E522702
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C320814Clone name: Petunia-DevA-27-F03
nocartOrdering Not Available
Library Name: Petunia-DevAOrganism: Petunia hybrida

Tissue: all floral organs
Development Stage: several

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E522702Length: 292 bp (752 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E522702 [] (trimmed) GCAGCACGAAGCCGAGCTTGCCGATGCTGCCAATCAACCCCTCCCAGATGATGATGATGAGACATTTGATTAAGAGTAATCAGCCATCTTTGCCA
GCATCTGTGGTGCAGTTGTGATTTTGTTTTTTTTCCTATGTACTGGTGTCCCATTTTTTCCACCATTGATGGGCTTCCGAGGACTCTGTCCAGAA
TATGTAGGCTTTTTGAACTCTGTTCTTGATCTATTTTCTATTTGGGTTGTGAGAAGGATATGAAGTTTTTATTCATATCTTTTGAAAAAAAAAAA
AAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E522702] SGN-U207956 Petunia hybrida Build 1 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T330174 [Download] [View] Facility Assigned ID: Petunia-DevA-27-F03.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0024 Quality Trim Threshold: 12.5