EST details — SGN-E522862

Search information 
Request: 522862Match: SGN-E522862
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C320974Clone name: Petunia-DevA-29-C07
nocartOrdering Not Available
Library Name: Petunia-DevAOrganism: Petunia hybrida

Tissue: all floral organs
Development Stage: several

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E522862Length: 490 bp (807 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E522862 [] (trimmed) ATAAGTTTGGAACTTTCCACTGGAATCCCCATGCTATACATTTTCAAAGAGGGAAAGTTTATCCGCAGAGGAAGTCCTCCAGCACCCACAGAGGC
AGGGGTCTATGCTTATACGAAGACCTTGGCTCAGTACAGACAAAAGCTAGATGAAAAGTTTCAGTAGTGCGACAAGGGGCTTGCTTTCAGTTGAA
GTAGATTCAATATGCCTCTGGGAGATTTTGTTTCTCATACAAATGGGAGGGATTTGTATTTTTATCTTCAATGTAGTCTTCGCATAGGCCAAACT
ACTAGGCCACTTTTTTCATGTATGTTGTTTTGTATGTGTAATGCTGTGAACTGTAATGTAGCATATGATGGTTTGATCAGTGTGATCCACAGACA
GAATAAGACAGTTAGCTGCAAGTAGTTTCGTTCATCTATATAGCCCATGTACATGGGCTTCTTTTTGCCAAAAAAAAAACCCACAACAAAAAAAA
AAAAAAAACACACAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E522862] SGN-U208097 Petunia hybrida Build 1 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T330334 [Download] [View] Facility Assigned ID: Petunia-DevA-29-C07.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0109 Quality Trim Threshold: 12.5