EST details — SGN-E524502

Search information 
Request: 524502Match: SGN-E524502
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C324438Clone name: Petunia-C2H4-19-E01
nocartOrdering Not Available
Library Name: Petunia-C2H4Organism: Petunia hybrida

Tissue: all floral organs
Development Stage: anthesis

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E524502Length: 537 bp (793 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E524502 [] (trimmed) AAGGGATCAATATGGGCCAAAAAGGTGGAGCCCCGATGAGCATGGGCCCGATGGGTCAAATGGGTGGCTATCCGATGGGCCAAATGGGGAATATG
CCGACAGCACAAGGACTACCCGCCTCTGGTGGTGGCGGGTATTTCCCTGGGATGGGGCAGGGCAACCCTTATGGTCAACAACAACAACAGTACAT
GGCACAAATGATGATGAACCAGCACCAGCAGCGGCCAGCCGGATACGACATGTATGGCCAACATCCGATGATGTACGCGAGACCACACCCTGCCG
TGAGTTATGGGCCACCTATGGGAGCTCCGGTGCATGATAATTTTACTCATATGTTCAGTGATGAGAATACAGGCAGTTGTAGTATCATGTAAATT
GTTAAAAAGGTTGTGCGAACTCTGTTTTGTTTCCTTCTATGAAATGATGAGGACTATGCTTTGGTCTTTTGGACAATTAATTGTAAGCATATCTT
GCATTGCCTATGTACTTTTTACCAAGTAGTGAGTATCTTGCATTGCCTATGTAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E524502] SGN-U207548 Petunia hybrida Build 1 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T335056 [Download] [View] Facility Assigned ID: Petunia-C2H4-19-E01.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0029 Quality Trim Threshold: 12.5