EST details — SGN-E524887
Search information |
Request: 524887 | Match: SGN-E524887 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C324823 | Clone name: Petunia-C2H4-22-E02 |
| ||
Library Name: Petunia-C2H4 | Organism: Petunia hybrida |
Tissue: all floral organs
Development Stage: anthesis
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E524887 | Length: 158 bp (1084 bp untrimmed) |
Status: Current Version | Direction: Unknown |
>SGN-E524887 [] (trimmed)
CCTTAGAAAAAGGAGACTTGGATCACAAAGCGTGTTAGGTCAATAGATACGTGGAAAGGTTCAAATGCTGTTTTCTTGGTTTTACTTCTTCAACT
AAACTATGAATGGATGTCTTAATATTTCACATTTTTTTTTTCAAAGCACCAATTTGGTGGCAT
AAACTATGAATGGATGTCTTAATATTTCACATTTTTTTTTTCAAAGCACCAATTTGGTGGCAT
Unigenes |
Current Unigene builds | |||||
[SGN-E524887] | SGN-U207562 | Petunia hybrida | Build 1 | 12 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T335345 [Download] [View] | Facility Assigned ID: Petunia-C2H4-22-E02.g |
Submitter: Dave Clark | Sequencing Facility: U Fla ICBR |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.937 | Expected Error Rate: 0.0236 | Quality Trim Threshold: 14.5 |