EST details — SGN-E524887
| Search information |
| Request: 524887 | Match: SGN-E524887 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C324823 | Clone name: Petunia-C2H4-22-E02 |
| ||
| Library Name: Petunia-C2H4 | Organism: Petunia hybrida |
Tissue: all floral organs
Development Stage: anthesis
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E524887 | Length: 158 bp (1084 bp untrimmed) |
| Status: Current Version | Direction: Unknown |
>SGN-E524887 [] (trimmed)
CCTTAGAAAAAGGAGACTTGGATCACAAAGCGTGTTAGGTCAATAGATACGTGGAAAGGTTCAAATGCTGTTTTCTTGGTTTTACTTCTTCAACT
AAACTATGAATGGATGTCTTAATATTTCACATTTTTTTTTTCAAAGCACCAATTTGGTGGCAT
AAACTATGAATGGATGTCTTAATATTTCACATTTTTTTTTTCAAAGCACCAATTTGGTGGCAT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E524887] | SGN-U207562 | Petunia hybrida | Build 1 | 12 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T335345 [Download] [View] | Facility Assigned ID: Petunia-C2H4-22-E02.g |
| Submitter: Dave Clark | Sequencing Facility: U Fla ICBR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.937 | Expected Error Rate: 0.0236 | Quality Trim Threshold: 14.5 |
Working
