EST details — SGN-E524887

Search information 
Request: 524887Match: SGN-E524887
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C324823Clone name: Petunia-C2H4-22-E02
nocartOrdering Not Available
Library Name: Petunia-C2H4Organism: Petunia hybrida

Tissue: all floral organs
Development Stage: anthesis

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E524887Length: 158 bp (1084 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E524887 [] (trimmed) CCTTAGAAAAAGGAGACTTGGATCACAAAGCGTGTTAGGTCAATAGATACGTGGAAAGGTTCAAATGCTGTTTTCTTGGTTTTACTTCTTCAACT
AAACTATGAATGGATGTCTTAATATTTCACATTTTTTTTTTCAAAGCACCAATTTGGTGGCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E524887] SGN-U207562 Petunia hybrida Build 1 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T335345 [Download] [View] Facility Assigned ID: Petunia-C2H4-22-E02.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0236 Quality Trim Threshold: 14.5