EST details — SGN-E525415

Search information 
Request: 525415Match: SGN-E525415
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C325352Clone name: Petunia-C2H4-28-A03
nocartOrdering Not Available
Library Name: Petunia-C2H4Organism: Petunia hybrida

Tissue: all floral organs
Development Stage: anthesis

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E525415Length: 341 bp (693 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E525415 [] (trimmed) AAAAGGTGGAGCCCCGATGAGCATTGTGCCCGATGGGGTCAAATGGGTGGCTATCCTGATGGGCCAAATGGGGAATATGCCGACAGCACAAGGAC
TACCCGCCTCTGGTGGTGGCGGGTATTTCCCTGGGATGGGTGCAGGGCAACCCTTATGGTCAACAACAACAACAGTACATGGCACAAATGATGAT
GAACCAGCACCAGCAGCGGCCAGCCGGATACGACATGTATGGCCAACATCCGATCATGTACGCGAGAACACACCCTGCCGTGAGTTATGGGCCAC
CTATGGGAGCTCCGGTGCATGATAATTTTACTCATATGTTCAGTGATGAGAATACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E525415] SGN-U207548 Petunia hybrida Build 1 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T336066 [Download] [View] Facility Assigned ID: Petunia-C2H4-28-A03.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0214 Quality Trim Threshold: 14.5