EST details — SGN-E525996

Search information 
Request: 525996Match: SGN-E525996
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C325933Clone name: Petunia-C2H4-4-A08
nocartOrdering Not Available
Library Name: Petunia-C2H4Organism: Petunia hybrida

Tissue: all floral organs
Development Stage: anthesis

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E525996Length: 239 bp (878 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E525996 [] (trimmed) GGAAATGTTCGATTCGGATGGATGAATGACTGTTACTGCTGCATCCGTTGTGTGTTTCTAAGAATCAGTTATGCAATGGTCATGATCGTGTCAGC
GAATGATATTGGATGTATAGGAATTTGGCTTTAGACTTTTAAGTGTAAAAATGAAGTATTAGATATTCTTTTGCAAACATCAATGTAGTAGTTCT
TATTCAAATATTTTAAACACGGGATTTCTTGAAACAAAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E525996] SGN-U207884 Petunia hybrida Build 1 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T333383 [Download] [View] Facility Assigned ID: Petunia-C2H4-4-A08.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.908 Expected Error Rate: 0.0008 Quality Trim Threshold: 12.5