Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E526086

Search information 
Request: 526086Match: SGN-E526086
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C326023Clone name: Petunia-C2H4-5-A02
nocartOrdering Not Available
Library Name: Petunia-C2H4Organism: Petunia hybrida

Tissue: all floral organs
Development Stage: anthesis

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E526086Length: 455 bp (513 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E526086 [] (trimmed) GTAGGCCTGCTGCTGCAGAAGGAGCAAGGATAGCAGGGGCTTCAAGGATTATCGGTGTGATTTGAATGCAAGCAGATTTGAGCTAGCAAAGAAAT
TTGGCGTGACAGAATTTGTGAACCCGAAGGACTATAACAAACCAGTTCAAGAGGTTATTGCTGAGATGACTGATGGAGGAGTCGACAGAAGCGTA
GAGTGCACTGGCCACATTGATGCTATGATTTCTGCATTTGAATGTGTCCATGATGGCTGGGGAGTGGCTGTACTTGTGGGAGTACCCCATAAAGA
AGCTGTGTTTAAGACACATCCAATGAACTTGTTGAATGAAAGGACTCTCAAGGGCACTTTCTTTGGGAACTACAAGCCACGATCCGATCTCCCTT
CTGTTGTGGAGAAATACATGAATAAGGAACTTGAATTGGAGAAGTTCATAACTCATCAACTCCCATTTTCTGATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E526086] SGN-U208383 Petunia hybrida Build 1 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T333473 [Download] [View] Facility Assigned ID: Petunia-C2H4-5-A02.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0063 Quality Trim Threshold: 14.5