Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E526431

Search information 
Request: 526431Match: SGN-E526431
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C326272Clone name: Petunia-C2H4-7-E11
nocartOrdering Not Available
Library Name: Petunia-C2H4Organism: Petunia hybrida

Tissue: all floral organs
Development Stage: anthesis

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C326272 [Petunia-C2H4-7-E11] Trace: SGN-T334202 EST: SGN-E526527 Direction: Unknown Facility: U Fla ICBR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E526431Length: 573 bp (901 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E526431 [] (trimmed) ATCATTTTGATGGTGAGAGTCAAGTAAAAGATTTTATTCAAACTCTCCTACATTATGGAGGGTACAATGAATTAGCTGACATTCTTGTCAATTTA
ACATCATTAGCAACAGAAATGGGAAAATTAGTTTCTGAAGGTTATGTGTTAACTGTTCTGGCGCCCAACGATGAGGCTATGGCTAAGCTGACAAC
TGATCAGCTTAGCGAGCCTGGGGCGCCAGAACAAATAATGTATTATCATTTGATACCGGAGTATCAAACGGAAGAAAGTATGTATAATGCTGTAA
GGAGATTTGGGAAAGTGAAGTATGATAGTTTGAGGTTACCACATAAAGTTGTTGCTGAAGAAGCTGATGGTTCAGTGAAATTTGGACAAGGTGAA
GGGTCAGCTTATTTGTTTGATCCTGATATTTACACTGATGGAAGGATCTCTGTACAAGGAATTGATGGTGTTCTGTTCCCTATTGAGGAAATTAC
GGTTGCTCCTGTAGCTGCCTCTGTTGCTACGGTTGTTGCAAAGCCAAGAAGAGGAACGTTGATGGAAGTAGCATGTAATATGCTGGGGTCATATG
CTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E526431] SGN-U207829 Petunia hybrida Build 1 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T333722 [Download] [View] Facility Assigned ID: Petunia-C2H4-7-E11.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0117 Quality Trim Threshold: 14.5