EST details — SGN-E526452

Search information 
Request: 526452Match: SGN-E526452
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C326293Clone name: Petunia-C2H4-7-G08
nocartOrdering Not Available
Library Name: Petunia-C2H4Organism: Petunia hybrida

Tissue: all floral organs
Development Stage: anthesis

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C326293 [Petunia-C2H4-7-G08] Trace: SGN-T334223 EST: SGN-E526548 Direction: Unknown Facility: U Fla ICBR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E526452Length: 446 bp (775 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E526452 [] (trimmed) CAAATGATGCTCATGCTCCACTGACCCGTCAACTGCTAGATCTCCAGTGGACTTTAGATTAAGTGAGCTGATTGATAAAATTCATCCAATGGAAG
CTAAGTTCTTTCGTTTTCTGAAGATTGTTGGAGTTGGTTTCAAGGCTCGAGCAGAATCCGAAGGCCGTCTCCTGTACCTTAAGCTAGGTTACAGC
CACGAGGTTGAACTGACTGTGCCTCCTGCCGTTCGTGTCTTCTGTTTCAAACCCAATGTGGTTTGCTGCACTGGGATTGACAAGTACAGGGTACA
CCAGTTTGCTGCTTCTGTAAGGAGCTGTAAGCCGCCTGAAGTTTACAAAGGCAAAGGCATTATGTACATTGATGAAGTGATTAAAAAGAAGCAAG
GCACGAAATCAAAATGAGAACATCGGTTCATGGTTATTTCTTGGACTTTCTTCCCTTTATTATGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E526452] SGN-U208266 Petunia hybrida Build 1 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T333743 [Download] [View] Facility Assigned ID: Petunia-C2H4-7-G08.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0092 Quality Trim Threshold: 14.5