EST details — SGN-E526875

Search information 
Request: 526875Match: SGN-E526875
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C326620Clone name: PetuniaLF-1-B11
nocartOrdering Not Available
Library Name: Petunia-LFOrganism: Petunia hybrida

Tissue: leaves
Development Stage: various

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E526875Length: 346 bp (857 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E526875 [] (trimmed) ATCTCCTCGGCAGCCGTTGCTACTAGCAGCAATGCTGTTCAAGCTAGCATGGTTGCACCTTTCACTGGCCTAAAATCTGCCTCAGCTTTCCCTGT
TACCAAGAAGAACAACCTTGACATTACTTCCCTTGCTAGCAATGGTGGAAGAGTTTCATGCATGCAGGTATGGCCACCATATGGAAAGAAGAAGT
ACGAGACACTCTCATACCTTCCCGATTTGACCGACGAACAATTTGCTCAAAGAAATTGAGTACCTTTTGAACAAGGGATGGGTTCCTTGCTTGGA
ATTCGAGACTGAGCACGGATTTGTCTACCGTGAATATCACGCATCACCAGGATACTATGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E526875] SGN-U207452 Petunia hybrida Build 1 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T336374 [Download] [View] Facility Assigned ID: PetuniaLF-1-B11.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0066 Quality Trim Threshold: 14.5