EST details — SGN-E526881

Search information 
Request: 526881Match: SGN-E526881
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C326626Clone name: PetuniaLF-1-C05
nocartOrdering Not Available
Library Name: Petunia-LFOrganism: Petunia hybrida

Tissue: leaves
Development Stage: various

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E526881Length: 284 bp (1467 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E526881 [] (trimmed) GGCTGATGAAGTTGTTCTTTTAGATAGTGATGTGAGTATGTTTGGGATGAGAGTCAGGATTGCCCTGGCTGAAAAGGGAATTCAGTATGAATACA
AGGAAGAGGACTTGAGGAACAAAACTCCTCTACTCCTCCAAATGAACCCCATTCACAAGAAAATCCCAGTCTTGATCCACAATGGAAAACCTGTT
TGTGAGTCACGCATCATTGTTCAGTACATTGATGAAGTTTGGAAGGACAAGTCTCCGTTGATGCCTTCTGATCCTTATAAGAGAGCTCAAGCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E526881] SGN-U208086 Petunia hybrida Build 1 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T336380 [Download] [View] Facility Assigned ID: PetuniaLF-1-C05.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0101 Quality Trim Threshold: 14.5